Tropomyosin 3 (TPM3) (NM_001278191) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CAPM1; CFTD; HEL-189; HEL-S-82p; hscp30; NEM1; OK/SW-cl.5; TM-5; TM3; TM5; TM30; TM30nm; TPM3nu; TPMsk3; TRK
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC334037 representing NM_001278191. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAA GAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATT GAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCTAAGTGTTCTGAGCTGGAGGAG GAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAGTACTCTCAAAAAGAA GATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTT GCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAA GAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001278191
Insert Size	477 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001278191.1
RefSeq Size	3058 bp
RefSeq ORF	477 bp
Locus ID	7170
UniProt ID	P06753
Protein Pathways	Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Pathways in cancer, Thyroid cancer
MW	18.6 kDa
Gene Summary	This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (9) differs in the 5' UTR and contains multiple differences in the coding region, compared to variant Tpm3.1. It initiates translation at a downstream in-frame start codon. The encoded isoform (9) is shorter than isoform Tpm3.1cy. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.