NDUFB8 (NM_001284368) Human Untagged Clone

CAT#: SC334008

NDUFB8 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa (NDUFB8), transcript variant 3



  "NM_001284368" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
NDUFB8 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASHI; CI-ASHI; MC1DN32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334008 representing NM_001284368.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCAAGGACATGTTCCCGGGGCCCTATCCTAGGACCCCAGAAGAACGGGCCGCCGCCGCCAAGAAG
TATAATATGCGTGTGGAAGACTACGAACCTTACCCGGATGATGGCATGGGGTATGGCGACTACCCGAAG
CTCCCTGACCGCTCACAGCATGAGAGAGATCCATGGTATAGCTGGGACCAGCCGGGCCTGAGGTTGAAC
TGGGGTGAACCGATGCACTGGCACCTAGACATGTACAACAGGAACCGTGTGGATACATCCCCCACACCT
GTTTCTTGGCATGTCATGTGTATGCAGCTCTTCGGTTTCCTGGCTTTCATGATATTCATGTGCTGGGTG
GGGGACGTGTACCCTGTCTACCAGCCTGTGGGACCAAAGCAGTATCCTTACAATAATCTGTACCTGGAA
CGAGGCGGTGATCCCTCCAAAGAACCAGAGCGGGTGGTTCACTATGAGATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001284368
Insert Size 468 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284368.1
RefSeq Size 667 bp
RefSeq ORF 468 bp
Locus ID 4714
UniProt ID O95169
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 18.5 kDa
Gene Summary Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' terminal exon, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...