NCE2 (UBE2F) (NM_001278307) Human Untagged Clone

CAT#: SC333994

UBE2F (untagged) - Human ubiquitin-conjugating enzyme E2F (putative) (UBE2F), transcript variant 4



  "NM_001278307" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UBE2F rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NCE2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333994 representing NM_001278307.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTAACGCTAGCAAGTAAACTGAAGCGTGACGATGGTCTCAAAGGGTCCCGGACGGCAGCCACAGCG
TCCGACTCGACTCGGAGGGTTTCTGTGAGAGACAAATTGCTTGTTAAAGATGAGGGTTACTACCAGGGT
GGAAAATTTCAGTTTGAAACTGAAGTTCCCGATGCGTACAACATGGTGCCTCCCAAAGTGAAATGCCTG
ACCAAGATCTGGCACCCCAACATCACAGAGACAGGGGAAATATGTCTGAGTTTATTGAGAGAACATTCA
ATTGATGGCACTGGCTGGGCTCCCACAAGAACATTAAAGGATGTCGTTTGGGGATTAAACTCTTTGTTT
ACTGATCTTTTGAATTTTGATGATCCACTGAATATTGAAGCTGCAGAACATCATTTGCGGGACAAGGAG
GACTTCCGGAATAAAGTGGATGACTACATCAAACGTTATGCCAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278307
Insert Size 462 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278307.1
RefSeq Size 2110 bp
RefSeq ORF 462 bp
Locus ID 140739
UniProt ID Q969M7
Protein Pathways Ubiquitin mediated proteolysis
MW 17.5 kDa
Gene Summary Accepts the ubiquitin-like protein NEDD8 from the UBA3-NAE1 E1 complex and catalyzes its covalent attachment to other proteins. The specific interaction with the E3 ubiquitin ligase RBX2, but not RBX1, suggests that the RBX2-UBE2F complex neddylates specific target proteins, such as CUL5.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two alternate exons in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...