MAGP2 (MFAP5) (NM_001297711) Human Untagged Clone

CAT#: SC333955

MFAP5 (untagged) - Human microfibrillar associated protein 5 (MFAP5), transcript variant 4



  "NM_001297711" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MFAP5 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AAT9; MAGP-2; MAGP2; MFAP-5; MP25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333955 representing NM_001297711.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGCTCTTGGGACCCAAGGTGCTGCTGTTTCTTGCTGCATTCATCATCACCTCTGACTGGATACCC
CTGGGGGTCAATAGTCAACGAGGAGACGATGTGACTCAAGCGACTCCAGAAACATTCACAGAAGATCCT
AATCTGGTGAATGATCCCGCTACAGATGAAACAGAGTGCTGGGATGAGAAATTTACCTGCACAAGGCTC
TACTCTGTGCATCGGCCGGTTAAACAATGCATTCATCAGTTATGCTTCACCAGTTTACGACGTATGTAC
ATCGTCAACAAGGAGATCTGCTCTCGTCTTGTCTGTAAGGAACACGAAGCTATGAAAGATGAGCTTTGC
CGTCAGATGGCTGGTCTGCCCCCTAGGAGACTCCGTCGCTCCAATTACTTCCGACTTCCTCCCTGTGAA
AATGTGGATTTGCAGAGACCCAATGGTCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001297711
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001297711.1
RefSeq Size 2874 bp
RefSeq ORF 447 bp
Locus ID 8076
Protein Families Secreted Protein
MW 17.1 kDa
Gene Summary This gene encodes a 25-kD microfibril-associated glycoprotein which is a component of microfibrils of the extracellular matrix. The encoded protein promotes attachment of cells to microfibrils via alpha-V-beta-3 integrin. Deficiency of this gene in mice results in neutropenia. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks two alternate in-frame exons in the coding region compared to variant 1. The encoded isoform (d) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...