DNA Polymerase epsilon (POLE3) (NM_001278255) Human Untagged Clone

CAT#: SC333936

POLE3 (untagged) - Human polymerase (DNA directed), epsilon 3, accessory subunit (POLE3), transcript variant 2



  "NM_001278255" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal POLE3 Antibody (N-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHARAC17; CHRAC2; CHRAC17; p17; YBL1
Vector pCMV6-Entry
Sequence Data
>SC333936 representing NM_001278255.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCAGGATCATCAAGGAGGCGCTC
CCGGACGGTGTCAACATCTCCAAGGAGGCCCGGAGCGCCATCTCCCGCGCCGCCAGCGTCTTCGTGCTG
TACGCCACATCCTGTGCTAACAACTTTGCAATGAAAGGAAAGCGGAAGACGCTGAATGCCAGTGATGTG
CTCTCAGCCATGGAAGAGATGGAGTTCCAGCGGTTCGTTACCCCATTGAAAGAAGCTCTGGAAGCATAT
AGGCGGGAGCAGAAAGGCAAGAAGGAGGCCTCAGAGCAAAAGAAGAAGGACAAAGACAAAAAAACAGAC
TCGGAAGAGCAAGACAAGAGCAGGGATGAGGACAATGATGAAGACGAAGAAAGGCTGGAAGAAGAAGAA
CAGAATGAAGAGGAAGAAGTAGACAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001278255
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278255.1
RefSeq Size 2258 bp
RefSeq ORF 444 bp
Locus ID 54107
UniProt ID Q9NRF9
Protein Pathways Base excision repair, DNA replication, Metabolic pathways, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism
MW 16.9 kDa
Gene Summary POLE3 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...