DNA Polymerase epsilon (POLE3) (NM_001278255) Human Untagged Clone
CAT#: SC333936
POLE3 (untagged) - Human polymerase (DNA directed), epsilon 3, accessory subunit (POLE3), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHARAC17; CHRAC2; CHRAC17; p17; YBL1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333936 representing NM_001278255.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCAGGATCATCAAGGAGGCGCTC CCGGACGGTGTCAACATCTCCAAGGAGGCCCGGAGCGCCATCTCCCGCGCCGCCAGCGTCTTCGTGCTG TACGCCACATCCTGTGCTAACAACTTTGCAATGAAAGGAAAGCGGAAGACGCTGAATGCCAGTGATGTG CTCTCAGCCATGGAAGAGATGGAGTTCCAGCGGTTCGTTACCCCATTGAAAGAAGCTCTGGAAGCATAT AGGCGGGAGCAGAAAGGCAAGAAGGAGGCCTCAGAGCAAAAGAAGAAGGACAAAGACAAAAAAACAGAC TCGGAAGAGCAAGACAAGAGCAGGGATGAGGACAATGATGAAGACGAAGAAAGGCTGGAAGAAGAAGAA CAGAATGAAGAGGAAGAAGTAGACAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278255 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278255.1 |
RefSeq Size | 2258 bp |
RefSeq ORF | 444 bp |
Locus ID | 54107 |
UniProt ID | Q9NRF9 |
Protein Pathways | Base excision repair, DNA replication, Metabolic pathways, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism |
MW | 16.9 kDa |
Gene Summary | POLE3 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236042 | POLE3 (myc-DDK-tagged) - Human polymerase (DNA directed), epsilon 3, accessory subunit (POLE3), transcript variant 2 |
CNY 3,990.00 |
|
RG236042 | POLE3 (tGFP-tagged) - Human polymerase (DNA directed), epsilon 3, accessory subunit (POLE3), transcript variant 2 |
CNY 4,370.00 |
其它DNA Polymerase epsilon产品