Endothelin 2 (EDN2) (NM_001302269) Human Untagged Clone

CAT#: SC333925

EDN2 (untagged) - Human endothelin 2 (EDN2), transcript variant 2



  "NM_001302269" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-EDN2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ET-2; ET2; PPET2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333925 representing NM_001302269.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCTCCGTGCCTACCACCTGGTGCTCCGTTGCGCTAGCCCTGCTCGTGGCCCTGCATGAAGGGAAG
GGCCAGGCTGCTGCCACCCTGGAGCAGCCAGCGTCCTCATCTCATGCCCAAGGCACCCACCTTCGGCTT
CGCCGTTGCTCCTGCAGCTCCTGGCTCGACAAGGAGTGCGTCTACTTCTGCCACTTGGACATCATCTGG
GTGAACACTCCTGAACAGACAGCTCCTTACGGCCTGGGAAACCCGCCAAGACGCCGGCGCCGCTCCCTG
CCAAGGCGCTGTCAGTGCTCCAGTGCCAGGGACCCCGCCTGTGCCACCTTCTGCCTTCGAAGGCCCTGG
GACATTTCCACAGTCAAGAGCCTCTTTGCCAAGCGACAACAGGAGGCCATGCGGGAGCCTCGGTCCACA
CATTCCAGGTGGAGGAAGAGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302269
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302269.1
RefSeq Size 1168 bp
RefSeq ORF 438 bp
Locus ID 1907
UniProt ID P20800
Protein Families Druggable Genome, Secreted Protein
MW 16.5 kDa
Gene Summary This gene encodes a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling events. This gene product is involved in a wide range of biological processes, such as hypertension and ovulation. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...