RHOD (NM_001300886) Human Untagged Clone

CAT#: SC333911

RHOD (untagged) - Human ras homolog family member D (RHOD), transcript variant 2



  "NM_001300886" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RHOD mouse monoclonal antibody, clone OTI2F7 (formerly 2F7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARHD; Rho; RHOHP1; RHOM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333911 representing NM_001300886.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGGCGGCCCAGGCCGCGGGTGAGGAGGCGCCACCAGGCGTGCGGTCCGTCAAGGTGGTCCTGGTG
GGCGACGGCGGCTGCGGGAAGACGTCGCTGCTGATGGTCTTCGCCGATGGGGCCTTCCCCGAGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGCGCAAG
GACAAATCACTGGTGAACAAGCTCCGAAGAAACGGATTGGAGCCTGTGACCTACCACAGGGGCCAGGAG
ATGGCGAGGTCCGTGGGCGCGGTGGCCTACCTCGAGTGCTCGGCTCGGCTCCATGACAACGTCCACGCC
GTCTTCCAGGAGGCCGCCGAGGTGGCCCTCAGCAGCCGCGGTCGCAACTTCTGGCGGCGGATTACCCAG
GGCTTTTGCGTGGTGACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300886
Insert Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300886.1
RefSeq Size 952 bp
RefSeq ORF 435 bp
Locus ID 29984
Protein Pathways Axon guidance
MW 15.7 kDa
Gene Summary Ras homolog, or Rho, proteins interact with protein kinases and may serve as targets for activated GTPase. They play a critical role in muscle differentiation. The protein encoded by this gene binds GTP and is a member of the small GTPase superfamily. It is involved in endosome dynamics and reorganization of the actin cytoskeleton, and it may coordinate membrane transport with the function of the cytoskeleton. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...