HSPA14 (NM_001278205) Human Untagged Clone

CAT#: SC333904

HSPA14 (untagged) - Human heat shock 70kDa protein 14 (HSPA14), transcript variant 3



  "NM_001278205" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Hsp 60 Antibody (N-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSP70-4; HSP70L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333904 representing NM_001278205.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCATCGGAGTTCACCTGGGCTGCACCTCAGCCTGTGTGGCCGTCTATAAGGATGGCCGGGCT
GGTGTGGTTGCAAATGATGCCGGTGACCGAGTTACTCCAGCTGTTGTTGCTTACTCAGAAAATGAAGAG
ATTGTTGGATTGGCAGCAAAACAAAGTAGAATAAGAAATATTTCAAATACAGTAATGAAAGTAAAGCAG
ATCCTGGGCAGAAGGGTGCTCTCAAGGGACCCCCAGCTACAGCAGCTCCCACAGCCTTTTCAGAGGTGC
AGTTGCTCCCTGTCAGAGCAGCCCCATGGCCAGACTGGGTGTGTCCGGGGAGCCCAGCCCCTGCACCAG
CACCAACCGCAGCACTCCTGGGGTAGCCTCCACACCGCAGACTCCAGTCTCCTCTTCGAGAGCTGGTTT
TGTTTCTGGTGGGGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278205
Insert Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278205.1
RefSeq Size 4110 bp
RefSeq ORF 432 bp
Locus ID 51182
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 15.7 kDa
Gene Summary Component of the ribosome-associated complex (RAC), a complex involved in folding or maintaining nascent polypeptides in a folding-competent state. In the RAC complex, binds to the nascent polypeptide chain, while DNAJC2 stimulates its ATPase activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate 3' exon in place of the last several exons compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...