LIAS (NM_001278591) Human Untagged Clone

CAT#: SC333893

LIAS (untagged) - Human lipoic acid synthetase (LIAS), transcript variant 4



  "NM_001278591" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-LIAS Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HGCLAS; HUSSY-01; LAS; LIP1; LS; PDHLD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333893 representing NM_001278591.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCTACGCTGCGGGGATGCAGCCCGCACCCTGGGGCCCCGGGTATTTGGGAGATATTTTTGCAGC
CCAGTCAGACCGTTAAGCTCCTTGCCAGATAAAAAAAAGGAACTCCTACAGAATGGACCAGACCTTCAA
GATTTTGTATCTGGTGATCTTGCAGACAGGAGCACCTGGGATGAATATAAAGGAAACCTAAAACGCCAG
AAAGGAGAAAGGTTAAGACTACCTCCATGGCTAAAGACAGAGATTCCCATGGGGAAAAATTACAATAAA
CTGAAAAATACTTTGCGGAATTTAAATCTCCATACAGTATGTGAGGAAGCTCGATGTCCCAATATTGGA
GAGTGTTGGGGAGGTGGAGAATATGCCACCGCCACAGCCACGATCATGGTAGGGCCAGCCTCAACCTCT
ATGGCTTTAGTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278591
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278591.1
RefSeq Size 702 bp
RefSeq ORF 429 bp
Locus ID 11019
UniProt ID O43766
Protein Pathways Lipoic acid metabolism, Metabolic pathways
MW 15.8 kDa
Gene Summary The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. Localized in the mitochondrion, this iron-sulfur enzyme catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. The deficient expression of this enzyme has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy. Alternative splicing occurs at this locus, and several transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (4) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (4) is much shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...