p23 (PTGES3) (NM_001282601) Human Untagged Clone

CAT#: SC333864

PTGES3 (untagged) - Human prostaglandin E synthase 3 (cytosolic) (PTGES3), transcript variant 2



  "NM_001282601" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PTGES3 mouse monoclonal antibody, clone OTI2D2 (formerly 2D2)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms cPGES; P23; TEBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333864 representing NM_001282601.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTCTTCATTGAATTTTGTGTTGAAGAC
AGTAAGGATGTTAATGTAAATTTTGAAAAATCCAAACTTACATTCAGTTGTCTCGGAGGAAGTGATAAT
TTTAAGCATTTAAATGAAATTGATCTTTTTCACTGTATTGATCCAAATGATTCCAAGCATAAAAGAACG
GACAGATCAATTTTATGTTGTTTACGAAAAGGAGAATCTGGCCAGTCATGGCCAAGGTTAACAAAAGAA
AGGGCAAAGCTTAATTGGCTTAGTGTCGACTTCAATAATTGGAAAGACTGGGAAGATGATTCAGATGAA
GACATGTCTAATTTTGATCGTTTCTCTGAGGATTCACAAGACAGTGATGATGAAAAAATGCCAGATCTG
GAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282601
Insert Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282601.1
RefSeq Size 1982 bp
RefSeq ORF 420 bp
Locus ID 10728
UniProt ID Q15185
Protein Families Druggable Genome, Nuclear Hormone Receptor
MW 16.5 kDa
Gene Summary This gene encodes an enzyme that converts prostaglandin endoperoxide H2 (PGH2) to prostaglandin E2 (PGE2). This protein functions as a co-chaperone with heat shock protein 90 (HSP90), localizing to response elements in DNA and disrupting transcriptional activation complexes. Alternative splicing results in multiple transcript variants. There are multiple pseudogenes of this gene on several different chromosomes. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...