PPCS (NM_001287506) Human Untagged Clone

CAT#: SC333854

PPCS (untagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 3



  "NM_001287506" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PPCS Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMD2C
Vector pCMV6-Entry
Sequence Data
>SC333854 representing NM_001287506.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTTACCTGGCTGCGGCTGTGTCAGATTTCTATGTTCCTGTCTCTGAAATGCCTGAACACAAGATC
CAGTCATCTGGGGGCCCACTGCAGATAACAATGAAGATGGTGCCAAAACTGCTTTCTCCTTTGGTTAAA
GATTGGGCTCCCAAAGCATTTATAATTTCCTTTAAGTTGGAGACTGACCCCGCCATTGTAATTAATCGA
GCTCGGAAGGCTTTGGAAATTTATCAGCATCAAGTGGTGGTGGCTAATATCCTTGAGTCACGACAGTCC
TTTGTGTTTATTGTAACCAAAGACTCGGAAACCAAGTTATTGCTATCAGAGGAAGAAATAGAAAAAGGC
GTAGAGATAGAAGAGAAGATAGTGGATAATCTTCAGTCTCGACACACAGCTTTTATAGGTGACAGAAAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001287506
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287506.1
RefSeq Size 1891 bp
RefSeq ORF 417 bp
Locus ID 79717
UniProt ID Q9HAB8
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
MW 15.6 kDa
Gene Summary Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) uses an alternate first exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 5, 6, and 7 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...