CCL28 (NM_001301874) Human Untagged Clone

CAT#: SC333748

CCL28 (untagged) - Human chemokine (C-C motif) ligand 28 (CCL28), transcript variant 3



  "NM_001301874" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CCL28 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCK1; MEC; SCYA28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333748 representing NM_001301874.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCAGAGAGGACTCGCCATCGTGGCCTTGGCTGTCTGTGCGGCCCTACATGCCTCAGAAGCCATA
CTTCCCATTGCCTCCAGCTGTTGCACGGAGGTTTCACATCATATTTCCAGAAGGCTCCTGGAAAGAGTG
AATATGTGTCGCATCCAGAGAGCTGATGGGGATTGTGACTTGGCTGCTGTCATCCTTCATGTCAAGCGC
AGAAGAATCTGTGTCAGCCCGCACAACCATACTGTTAAGCAGTGGATGAAAGTGCAAGCTGCCAAGAAA
AATGGTAAAGGAAATGTTTGCCACAGGAAGAAACACCATGGCAAGAGGAACAGTAACAGGGCACATCAG
GGGAAACACGAAACATACGGCCATAAAACTCCTTATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301874
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301874.1
RefSeq Size 774 bp
RefSeq ORF 384 bp
Locus ID 56477
UniProt ID Q9NRJ3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW 14.3 kDa
Gene Summary This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (3) differs in the 3' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...