LSM4 (NM_001252129) Human Untagged Clone
CAT#: SC333718
LSM4 (untagged) - Human LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM4), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GRP; YER112W |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333718 representing NM_001252129.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTGGTGGAGCTGAAAAATGGGGAGACGTACAATGGACACCTGGTGAGCTGCGACAACTGGATGAAC ATTAACCTGCGAGAAGTCATCTGCACGTCCAGGGACGGGGACAAGTTCTGGCGGATGCCCGAGTGCTAC ATCCGCGGCAGCACCATCAAGTACCTGCGCATCCCCGACGAGATCATCGACATGGTCAAGGAGGAGGTG GTGGCCAAGGGCCGCGGCCGCGGAGGCCTGCAGCAGCAGAAGCAGCAGAAAGGCCGCGGCATGGGCGGC GCTGGCCGAGGTGTGTTTGGTGGCCGGGGCCGAGGTGGGATCCCGGGCACAGGCAGAGGCCAGCCAGAG AAGAAGCCTGGCAGACAGGCGGGCAAACAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252129 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001252129.1 |
RefSeq Size | 1783 bp |
RefSeq ORF | 378 bp |
Locus ID | 25804 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | RNA degradation, Spliceosome |
MW | 13.8 kDa |
Gene Summary | This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) lacks an exon in the 5' coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235824 | LSM4 (myc-DDK-tagged) - Human LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM4), transcript variant 2 |
CNY 3,990.00 |
|
RG235824 | LSM4 (tGFP-tagged) - Human LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM4), transcript variant 2 |
CNY 4,370.00 |