LSM4 (NM_001252129) Human Untagged Clone

CAT#: SC333718

LSM4 (untagged) - Human LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM4), transcript variant 2



  "NM_001252129" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
LSM4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GRP; YER112W
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333718 representing NM_001252129.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGGTGGAGCTGAAAAATGGGGAGACGTACAATGGACACCTGGTGAGCTGCGACAACTGGATGAAC
ATTAACCTGCGAGAAGTCATCTGCACGTCCAGGGACGGGGACAAGTTCTGGCGGATGCCCGAGTGCTAC
ATCCGCGGCAGCACCATCAAGTACCTGCGCATCCCCGACGAGATCATCGACATGGTCAAGGAGGAGGTG
GTGGCCAAGGGCCGCGGCCGCGGAGGCCTGCAGCAGCAGAAGCAGCAGAAAGGCCGCGGCATGGGCGGC
GCTGGCCGAGGTGTGTTTGGTGGCCGGGGCCGAGGTGGGATCCCGGGCACAGGCAGAGGCCAGCCAGAG
AAGAAGCCTGGCAGACAGGCGGGCAAACAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001252129
Insert Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252129.1
RefSeq Size 1783 bp
RefSeq ORF 378 bp
Locus ID 25804
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation, Spliceosome
MW 13.8 kDa
Gene Summary This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...