Glutathione S Transferase theta 1 (GSTT1) (NM_001293810) Human Untagged Clone

CAT#: SC333692

GSTT1 (untagged) - Human glutathione S-transferase theta 1 (GSTT1), transcript variant 5



  "NM_001293810" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to GSTT1 (glutathione S-transferase theta 1)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333692 representing NM_001293810.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCCTGTTTTCCTGGGTGAGCCAGTATCTCCCCAGACACTGGCAGCCACCCTGGCAGAGTTGGAT
GTGACCCTGCAGTTGCTCGAGGACAAGTTCCTCCAGAACAAGGCCTTCCTTACTGGTCCTCACATCTCC
TTAGCTGACCTCGTAGCCATCACGGAGCTGATGCATCCCGTGGGTGCTGGCTGCCAAGTCTTCGAAGGC
CGACCCAAGCTGGCCACATGGCGGCAGCGCGTGGAGGCAGCAGTGGGGGAGGACCTCTTCCAGGAGGCC
CATGAGGTCATTCTGAAGGCCAAGGACTTCCCACCTGCAGACCCCACCATAAAGCAGAAGCTGATGCCC
TGGGTGCTGGCCATGATCCGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001293810
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293810.1
RefSeq Size 1021 bp
RefSeq ORF 369 bp
Locus ID 2952
UniProt ID P30711
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
MW 13.5 kDa
Gene Summary The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (5) lacks an alternate exon, resulting in an alternate 5' UTR and translation initiation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Variants 3, 4, 5, 6 and 7 all encode isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Glutathione S Transferase theta 1产品

Customer Reviews 
Loading...