POLR2H (NM_001278714) Human Untagged Clone

CAT#: SC333687

POLR2H (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 5



  "NM_001278714" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


POLR2H mouse monoclonal antibody,clone OTI4A12
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RPABC3; RPB8; RPB17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333687 representing NM_001278714.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAGAAGTTTGAC
CGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATCTTAGATGTAAACATTCAA
ATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATAGCTAGTACCTTGTATGAAGATGGTACC
CTGGATGATGGTGAATACAACCCCACTGATGATAGGCCTTCCAGCTCTGCGTACGTGTCCTATGGGGGC
CTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTCCAGAGTTTATCTC
CTGATGAAGAAGCTAGCCTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278714
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278714.1
RefSeq Size 1180 bp
RefSeq ORF 369 bp
Locus ID 5437
UniProt ID P52434
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 13.8 kDa
Gene Summary The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) lacks an alternate in-frame exon in the 5' coding region and uses an alternate splice site in the 3' coding region, resulting in a frameshift, compared to variant 1. It encodes isoform 4, which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...