POLR2F (NM_001301129) Human Untagged Clone

CAT#: SC333650

POLR2F (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide F (POLR2F), transcript variant 2



  "NM_001301129" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
POLR2F mouse monoclonal antibody,clone OTI2F2
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HRBP14.4; POLRF; RPABC2; RPABC14.4; RPB6; RPB14.4; RPC15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333650 representing NM_001301129.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCTCGATCTCCTGCCTTGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGAAGGC
CAGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGCCAACCAGAAGCGAATCACCACACCA
TACATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCGCTCCAGATTGCGATGTGTGCCCCT
GTGATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCATGAAGGAACTCAAGGCCCGAAAG
ATCCCCATCATCATTCGCCGTTACCTGCCAGATGGGAGCTATGAAGACTGGGGGGTGGACGAGCTCATC
ATCACCGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301129
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301129.1
RefSeq Size 2207 bp
RefSeq ORF 357 bp
Locus ID 5435
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 13.3 kDa
Gene Summary This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) contains an alternate exon in the 5' region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...