MAP2K1IP1 (LAMTOR3) (NM_001243736) Human Untagged Clone

CAT#: SC333642

LAMTOR3 (untagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 (LAMTOR3), transcript variant 3



  "NM_001243736" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to MP1 (MAPK scaffold protein 1)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MAP2K1IP1; MAPBP; MAPKSP1; MP1; PRO0633; Ragulator3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333642 representing NM_001243736.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGATGACCTAAAGCGATTCTTGTATAAAAAGTTACCAAGTGTTGAAGGGCTCCATGCCATTGTT
GTGTCAGATAGAGATGGAGTACCTGTTATTAAAGAGCATGCTTTGCGACCTGGTTTCTTATCCACTTTT
GCCCTTGCAACAGACCAAGGAAGCAAACTTGGACTTTCCAAAAATAAAAGTATCATCTGTTACTATAAC
ACCTACCAGGTGGTTCAATTTAATCGTTTACCTTTGGTGGTGAGTTTCATAGCCAGCAGCAGTGCCAAT
ACAGGACTAATTGTCAGCCTAGAAAAGGAACTTGCTCCATTGTTTGAAGAACTGAGACAAGTTGTGGAA
GTTTCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001243736
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243736.1
RefSeq Size 4259 bp
RefSeq ORF 354 bp
Locus ID 8649
UniProt ID Q9UHA4
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway
MW 12.9 kDa
Gene Summary This gene encodes a scaffold protein that functions in the extracellular signal-regulated kinase (ERK) cascade. The protein is localized to late endosomes by the mitogen-activated protein-binding protein-interacting protein, and binds specifically to MAP kinase kinase MAP2K1/MEK1, MAP kinase MAPK3/ERK1, and MAP kinase MAPK1/ERK2. Studies of the orthologous gene in mouse indicate that it regulates late endosomal traffic and cell proliferation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 13. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...