MAP2K1IP1 (LAMTOR3) (NM_001243736) Human Untagged Clone
CAT#: SC333642
LAMTOR3 (untagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 (LAMTOR3), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MAP2K1IP1; MAPBP; MAPKSP1; MP1; PRO0633; Ragulator3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333642 representing NM_001243736.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGATGACCTAAAGCGATTCTTGTATAAAAAGTTACCAAGTGTTGAAGGGCTCCATGCCATTGTT GTGTCAGATAGAGATGGAGTACCTGTTATTAAAGAGCATGCTTTGCGACCTGGTTTCTTATCCACTTTT GCCCTTGCAACAGACCAAGGAAGCAAACTTGGACTTTCCAAAAATAAAAGTATCATCTGTTACTATAAC ACCTACCAGGTGGTTCAATTTAATCGTTTACCTTTGGTGGTGAGTTTCATAGCCAGCAGCAGTGCCAAT ACAGGACTAATTGTCAGCCTAGAAAAGGAACTTGCTCCATTGTTTGAAGAACTGAGACAAGTTGTGGAA GTTTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243736 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243736.1 |
RefSeq Size | 4259 bp |
RefSeq ORF | 354 bp |
Locus ID | 8649 |
UniProt ID | Q9UHA4 |
Protein Families | Druggable Genome |
Protein Pathways | MAPK signaling pathway |
MW | 12.9 kDa |
Gene Summary | This gene encodes a scaffold protein that functions in the extracellular signal-regulated kinase (ERK) cascade. The protein is localized to late endosomes by the mitogen-activated protein-binding protein-interacting protein, and binds specifically to MAP kinase kinase MAP2K1/MEK1, MAP kinase MAPK3/ERK1, and MAP kinase MAPK1/ERK2. Studies of the orthologous gene in mouse indicate that it regulates late endosomal traffic and cell proliferation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 13. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235748 | LAMTOR3 (myc-DDK-tagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 (LAMTOR3), transcript variant 3 |
CNY 3,990.00 |
|
RG235748 | LAMTOR3 (tGFP-tagged) - Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 (LAMTOR3), transcript variant 3 |
CNY 4,370.00 |
其它MAP2K1IP1产品