Calcipressin 1 (RCAN1) (NM_001285392) Human Untagged Clone

CAT#: SC333638

RCAN1 (untagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 6



  "NM_001285392" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RCAN1 mouse monoclonal antibody,clone OTI10C6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1
Vector pCMV6-Entry
Sequence Data
>SC333638 representing NM_001285392.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTGGCTCCGCCAAATCCAGACAAG
CAGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAGTGGAAGATGCGACCCCAGTC
ATAAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAAGTATGAATTGCACGCAGCG
ACTGACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAGAAGGAGGAAGAAGAGGAA
ATGGAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGGAGTACACGCCGATCCAC
CTCAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001285392
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285392.2
RefSeq Size 2327 bp
RefSeq ORF 354 bp
Locus ID 1827
UniProt ID P53805
Protein Families Transcription Factors
MW 13.3 kDa
Gene Summary The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (6) uses an alternate promoter and 5' exon compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...