Calcipressin 1 (RCAN1) (NM_001285392) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333638 representing NM_001285392. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTGGCTCCGCCAAATCCAGACAAG CAGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAGTGGAAGATGCGACCCCAGTC ATAAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAAGTATGAATTGCACGCAGCG ACTGACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAGAAGGAGGAAGAAGAGGAA ATGGAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGGAGTACACGCCGATCCAC CTCAGCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001285392
Insert Size	354 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001285392.2
RefSeq Size	2327 bp
RefSeq ORF	354 bp
Locus ID	1827
UniProt ID	P53805
Protein Families	Transcription Factors
MW	13.3 kDa
Gene Summary	The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (6) uses an alternate promoter and 5' exon compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.