Nociceptin (PNOC) (NM_001284244) Human Untagged Clone

CAT#: SC333581

PNOC (untagged) - Human prepronociceptin (PNOC), transcript variant 2



  "NM_001284244" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PNOC Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms N/OFQ; NOP; OFQ; ppN/OFQ; PPNOC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333581 representing NM_001284244.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGGAGCTCTTGGCAGCTCAGCCCTGCCGCCCCAGAGCATGTGGCGGCTGCTCTCTACCAGCCG
AGAGCTTCGGAGATGCAGCATCTGCGGCGAATGCCCCGAGTCCGGAGCTTGTTCCAGGAGCAGGAAGAG
CCCGAGCCTGGCATGGAGGAGGCTGGTGAGATGGAGCAGAAGCAGCTGCAGAAGAGATTTGGGGGCTTC
ACCGGGGCCCGGAAGTCGGCCAGGAAGTTGGCCAATCAGAAGCGGTTCAGTGAGTTTATGAGGCAATAC
TTGGTCCTGAGCATGCAGTCCAGCCAGCGCCGGCGCACCCTGCACCAGAATGGTAATGTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001284244
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284244.1
RefSeq Size 1022 bp
RefSeq ORF 339 bp
Locus ID 5368
UniProt ID Q13519
Protein Families Secreted Protein
MW 13 kDa
Gene Summary This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include nociceptin, nocistatin, and orphanin FQ2 (OFQ2). Nociceptin, also known as orphanin FQ, is a 17-amino acid neuropeptide that binds to the nociceptin receptor to induce increased pain sensitivity, and may additionally regulate body temperature, learning and memory, and hunger. Another product of the encoded preproprotein, nocistatin, may inhibit the effects of nociceptin. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start site compared to variant 1. The encoded isoform (2) lacks a signal peptide sequence and has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...