HERC4 (NM_001278187) Human Untagged Clone
CAT#: SC333579
HERC4 (untagged) - Human HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333579 representing NM_001278187.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTGTGCTGGGGAAATGCATCCTTTGGGCAGCTAGGTTTGGGTGGAATTGATGAAGAAATTGTACTA GAGCCCAGAAAAAGTGACTTCTTTATAAATAAAAGGGTCCGAGATGTAGGATGTGGACTCAGACATACT GTGTTTGTTCTGGATGATGGAACAGTGTACACATGTGGATGTAATGATCTAGGACAGCTAGGTCATGAA AAATCCAGAAAGAAACCAGAGTTTCGCTCTTGTTTCCCAGGCCGGAGTGCAATGGCGCCATCTCGGCTC ACCGCAACCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCCGAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278187 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278187.1 |
RefSeq Size | 2147 bp |
RefSeq ORF | 333 bp |
Locus ID | 26091 |
UniProt ID | Q5GLZ8 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
MW | 12 kDa |
Gene Summary | HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (5) has an alternate 3'-most exon in place of most of the rest of the transcript compared to variant 1. The resulting isoform (e) has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235685 | HERC4 (myc-DDK-tagged) - Human HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant 5 |
CNY 3,990.00 |
|
RG235685 | HERC4 (tGFP-tagged) - Human HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant 5 |
CNY 4,370.00 |