HERC4 (NM_001278187) Human Untagged Clone

CAT#: SC333579

HERC4 (untagged) - Human HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant 5



  "NM_001278187" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HERC4 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333579 representing NM_001278187.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGTGCTGGGGAAATGCATCCTTTGGGCAGCTAGGTTTGGGTGGAATTGATGAAGAAATTGTACTA
GAGCCCAGAAAAAGTGACTTCTTTATAAATAAAAGGGTCCGAGATGTAGGATGTGGACTCAGACATACT
GTGTTTGTTCTGGATGATGGAACAGTGTACACATGTGGATGTAATGATCTAGGACAGCTAGGTCATGAA
AAATCCAGAAAGAAACCAGAGTTTCGCTCTTGTTTCCCAGGCCGGAGTGCAATGGCGCCATCTCGGCTC
ACCGCAACCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCCGAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278187
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278187.1
RefSeq Size 2147 bp
RefSeq ORF 333 bp
Locus ID 26091
UniProt ID Q5GLZ8
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
MW 12 kDa
Gene Summary HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (5) has an alternate 3'-most exon in place of most of the rest of the transcript compared to variant 1. The resulting isoform (e) has a shorter and distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...