RPL36A (NM_001199972) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	L36A; L44L; MIG6; RPL44
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333549 representing NM_001199972. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTGCTCCTACCGACTCCCATGAGGAAGTGCGATCGGGAACCTCCTATATACTTCCGTTTGCCTCG CGGTTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT TTCTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTG TACGCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTC CGGAAAAAGGTGAGTGGTAGTTACTATTTGACGTTTCCCAGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001199972
Insert Size	321 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001199972.1
RefSeq Size	2361 bp
RefSeq ORF	321 bp
Locus ID	6173
Protein Pathways	Ribosome
MW	12.1 kDa
Gene Summary	Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.