Ninjurin2 (NINJ2) (NM_001294346) Human Untagged Clone

CAT#: SC333546

NINJ2 (untagged) - Human ninjurin 2 (NINJ2), transcript variant 3



  "NM_001294346" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333546 representing NM_001294346.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGACGTGGCCCTGTTCATGTCCAACGCCATGCGGCTGAAGGCGGTGCTGGAGCAGGGACCATCC
TCTCACTACTACACCACCCTGGTCACCCTCATCAGCCTCTCTCTGCTCCTGCAGGTGGTCATCGGTGTC
CTGCTCGTGGTCATTGCACGGCTGAACCTGAATGAGGTAGAAAAGCAGTGGCGACTCAACCAGCTCAAC
AACGCAGCCACCATCTTGGTCTTCTTCACTGTGGTCATCAATGTTTTCATTACAGCCTTCGGGGCACAT
AAAACAGGGTTCCTGGCTGCCAGGGCCTCAAGGAATCCTCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001294346
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001294346.1
RefSeq Size 986 bp
RefSeq ORF 321 bp
Locus ID 4815
UniProt ID Q9NZG7
Protein Families Transmembrane
MW 11.7 kDa
Gene Summary The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) contains an alternate 5' terminal exon which results in a different 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Variants 3 and 4 both encode the same isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...