PEN2 (PSENEN) (NM_001281532) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ACNINV2; MDS033; MSTP064; PEN-2; PEN2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333491 representing NM_001281532. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAACCTGGAGCGAGTGTCCAATGAGGAGAAATTGAACCTGTGCCGGAAGTACTACCTGGGGGGGTTT GCTTTCCTGCCTTTTCTCTGGTTGGTCAACATCTTCTGGTTCTTCCGAGAGGCCTTCCTTGTCCCAGCC TACACAGAACAGAGCCAAATCAAAGGCTATGTCTGGCGCTCAGCTGTGGGCTTCCTCTTCTGGGTGATA GTGCTCACCTCCTGGATCACCATCTTCCAGATCTACCGGCCCCGCTGGGGTGCCCTTGGGGACTACCTC TCCTTCACCATACCCCTGGGCACCCCCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001281532
Insert Size	306 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001281532.1
RefSeq Size	796 bp
RefSeq ORF	306 bp
Locus ID	55851
UniProt ID	Q9NZ42
Protein Families	Druggable Genome, Transmembrane
Protein Pathways	Alzheimer's disease, Notch signaling pathway
MW	12 kDa
Gene Summary	Presenilins, which are components of the gamma-secretase protein complex, are required for intramembranous processing of some type I transmembrane proteins, such as the Notch proteins and the beta-amyloid precursor protein. Signaling by Notch receptors mediates a wide range of developmental cell fates. Processing of the beta-amyloid precursor protein generates neurotoxic amyloid beta peptides, the major component of senile plaques associated with Alzheimer's disease. This gene encodes a protein that is required for Notch pathway signaling, and for the activity and accumulation of gamma-secretase. Mutations resulting in haploinsufficiency for this gene cause familial acne inversa-2 (ACNINV2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.