NDUFB6 (NM_001199987) Human Untagged Clone
CAT#: SC333473
NDUFB6 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B17; CI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333473 representing NM_001199987.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGGGGTACACTCCGGATGAGAAACTGCGGCTGCAGCAGCTGCGAGAGCTGAGAAGGCGATGGCTG AAGGACCAGGAGCTGAGCCCTCGGGAGCCGGTGCTGCCCCCACAGAAGATGGGGCCTATGGAGAAATTC TGGAATAAATTTTTGGAGAATAAATCCCCTTGGAGGAAAATGGAAAAACCATATGGCATAGTTGAAAAG AAGTCCAGAATATTCCCTGGTGATACAATTCTGGAGACTGGAGAAGTAATTCCACCAATGAAAGAATTT CCTGATCAACATCATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199987 |
Insert Size | 294 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199987.1 |
RefSeq Size | 780 bp |
RefSeq ORF | 294 bp |
Locus ID | 4712 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 11.7 kDa |
Gene Summary | The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235579 | NDUFB6 (myc-DDK-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), transcript variant 3 |
CNY 3,990.00 |
|
RG235579 | NDUFB6 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), transcript variant 3 |
CNY 4,370.00 |