FXYD1 (NM_001278718) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	PLM
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333455 representing NM_001278718. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGTCTCTTGGCCACATCTTGGTTTTCTGTGTGGGTCTCCTCACCATGGCCAAGGCAGAAAGTCCA AAGGAACACGACCCGTTCACTTACGACTACCAGTCCCTGCAGATCGGAGGCCTCGTCATCGCCGGGATC CTCTTCATCCTGGGCATCCTCATCGTGCTGAGCAGAAGATGCCGGTGCAAGTTCAACCAGCAGCAGAGG ACTGGGGAACCCGATGAAGAGGAGGGAACTTTCCGCAGCTCCATCCGCCGTCTGTCCACCCGCAGGCGG TAG
Restriction Sites	SgfI-MluI
ACCN	NM_001278718
Insert Size	279 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001278718.1
RefSeq Size	603 bp
RefSeq ORF	279 bp
Locus ID	5348
UniProt ID	O00168
Protein Families	Ion Channels: Other, Transmembrane
MW	10.4 kDa
Gene Summary	This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. Transcript variants with different 5' UTR sequences have been described in the literature. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (d) differs in the 5' UTR compared to variant a. Variants a, b, c and d encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.