UCMA (NM_001303119) Human Untagged Clone
CAT#: SC333417
UCMA (untagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C10orf49; GRP; GRP/UCMA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333417 representing NM_001303119.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTTGGAGACAGGCCGTCCTGCTGTCTTGCTTCTCCGCCGTGGTGCTCCTGTCTATGGAAAACAGG CAGAAGCTTCGGGTTGATGAGCTGCGGAGAGAATATTACGAGGAACAAAGGAATGAATTTGAGAACTTC GTGGAGGAACAAAACGATGAGCAGGAAGAGAGGAGCCGGGAGGCTGTGGAGCAGTGGCGCCAGTGGCAC TATGACGGCCTGCACCCATCCTATCTCTACAACCGCCACCACACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303119 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303119.1 |
RefSeq Size | 662 bp |
RefSeq ORF | 255 bp |
Locus ID | 221044 |
UniProt ID | Q8WVF2 |
Protein Families | Secreted Protein |
MW | 10.6 kDa |
Gene Summary | This gene encodes a chondrocyte-specific, highly charged protein that is abundantly expressed in the upper immature zone of fetal and juvenile epiphyseal cartilage. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Undercarboxylation of the encoded protein is associated with osteoarthritis in humans. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (3) lacks two alternate in-frame exons compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235523 | UCMA (myc-DDK-tagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 3 |
CNY 3,990.00 |
|
RG235523 | UCMA (tGFP-tagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 3 |
CNY 4,370.00 |