Apc11 (ANAPC11) (NM_001289414) Human Untagged Clone
CAT#: SC333413
ANAPC11 (untagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 8
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
ANAPC11 (Apc11) mouse monoclonal antibody, clone OTI3C4 (formerly 3C4)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APC11; Apc11p; HSPC214 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333413 representing NM_001289414.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGT GGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCGGCGACGACTGCCCGCTG GTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTG CAGCAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289414 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289414.1 |
RefSeq Size | 859 bp |
RefSeq ORF | 255 bp |
Locus ID | 51529 |
UniProt ID | Q9NYG5 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
MW | 9.8 kDa |
Gene Summary | Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) lacks an exon and contains two alternate exons in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...