PPCDC (NM_001301105) Human Untagged Clone

CAT#: SC333402

PPCDC (untagged) - Human phosphopantothenoylcysteine decarboxylase (PPCDC), transcript variant 6



  "NM_001301105" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PPCDC Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms coaC; MDS018; PPC-DC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333402 representing NM_001301105.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGGCCTGGGACCGCAGCAAGCCCCTGCTCTTCTGCCCGGCCATGAACACCGCCATGTGGGAGCAC
CCGATCACAGCGCAGCAGGTAGACCAGCTCAAGGCCTTTGGCTATGTCGAGATCCCCTGTGTGGCCAAG
AAGCTGGTGTGCGGAGATGAAGGTCTCGGGGCCATGGCTGAAGTGGGGACCATCGTGGACAAAGTGAAA
GAAGTCCTCTTCCAGCACAGTGGCTTCCAGCAGAGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301105
Insert Size 246 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301105.1
RefSeq Size 2065 bp
RefSeq ORF 246 bp
Locus ID 60490
UniProt ID Q96CD2
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
MW 9 kDa
Gene Summary Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (6) contains alternate 5' exon structure, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (e) is shorter at the N-terminus, compared to isoform a. Both variants 5 and 6 encode isoform e.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...