CCL28 (NM_001301875) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CCK1; MEC; SCYA28
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333398 representing NM_001301875. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTCGCATCCAGAGAGCTGATGGGGATTGTGACTTGGCTGCTGTCATCCTTCATGTCAAGCGCAGA AGAATCTGTGTCAGCCCGCACAACCATACTGTTAAGCAGTGGATGAAAGTGCAAGCTGCCAAGAAAAAT GGTAAAGGAAATGTTTGCCACAGGAAGAAACACCATGGCAAGAGGAACAGTAACAGGGCACATCAGGGG AAACACGAAACATACGGCCATAAAACTCCTTATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001301875
Insert Size	243 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001301875.1
RefSeq Size	3217 bp
RefSeq ORF	243 bp
Locus ID	56477
Protein Families	Druggable Genome, Secreted Protein
Protein Pathways	Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW	9.3 kDa
Gene Summary	This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (4) uses an alternate promoter, as evidenced by epigenomic data, and has an alternate 5' terminal exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.