CLPS (NM_001252598) Human Untagged Clone

CAT#: SC333352

CLPS (untagged) - Human colipase, pancreatic (CLPS), transcript variant 3



  "NM_001252598" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CLPS Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333352 representing NM_001252598.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAAGATCCTGATCCTCCTGCTTGTCGCCCTCTCTGTGGCCTATGCAGCTCCTGGCCCCCGGGGG
ATCATTATCAACCTGACGCTCTATGGGATTTACTACAAGTGTCCCTGTGAGCGTGGCCTGACCTGTGAG
GGAGACAAGACCATCGTGGGCTCCATCACCAACACCAACTTTGGCATCTGCCATGACGCTGGACGCTCC
AAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001252598
Insert Size 216 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252598.1
RefSeq Size 455 bp
RefSeq ORF 216 bp
Locus ID 1208
Protein Families Secreted Protein, Transmembrane
MW 7.7 kDa
Gene Summary The protein encoded by this gene is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilizing an active conformation and considerably increasing the overall hydrophobic binding site. The gene product allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. This cofactor is only expressed in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...