Cylicin 1 (CYLC1) (NM_001271680) Human Untagged Clone

CAT#: SC333344

CYLC1 (untagged) - Human cylicin, basic protein of sperm head cytoskeleton 1 (CYLC1), transcript variant 2



  "NM_001271680" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CYLC1 Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CYCL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333344 representing NM_001271680.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCTTCCAAGGCTAAAAGTAAACATCAGAACATATGATAATTCCATTCCAATCAGTGAATCAAGC
AGAAAATCATGGAATCAAAAACACTTTGCTTTGACATTTCCCAAACCACTCCAGAGAGGTACAAATGAT
AAATCAAGACCTTTGAAATCACAAATAACAGTTACTCCTGAAGCACCGTGGATTCATAAGCTGCTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001271680
Insert Size 207 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271680.1
RefSeq Size 394 bp
RefSeq ORF 207 bp
Locus ID 1538
MW 7.9 kDa
Gene Summary This gene encodes a sperm head cytoskeletal protein. The encoded protein is associated with the calyx of spermatozoa and spermatids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site and lacks an alternate in-frame exon compared to variant 1. It encodes a shorter protein (isoform 2) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...