Surb7 (MED21) (NM_001271811) Human Untagged Clone

CAT#: SC333342

MED21 (untagged) - Human mediator complex subunit 21 (MED21), transcript variant 2



  "NM_001271811" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MED21 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hSrb7; SRB7; SURB7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333342 representing NM_001271811.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGATCGGCTCACGCAGCTTCAGGACGCTGTGAATTCGCTTGCAGATCAGTTTTGTAATGCCATT
GGAGTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGACAGCAATTAACAAAGACCAG
CCAGCTAACCCTACAGAAGTATGCCCAGCTTTTTGCAGCACTGATTGCACGAACAGCAAAAGACATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001271811
Insert Size 207 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271811.1
RefSeq Size 2703 bp
RefSeq ORF 207 bp
Locus ID 9412
Protein Families Transcription Factors
MW 7.3 kDa
Gene Summary This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) uses an alternate splice site in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...