XPNPEP3 (NM_001204827) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	APP3; ICP55; NPHPL1
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333314 representing NM_001204827. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTTGGCTGCTCTCAGCCCCCAAGCTGGTTCCCGCTGTAGCAAACGTCCGCGGCCTCTCAGGGTCT TACTTTGTCACCCAAGCTGGAGTGCAGTGGCGTGATCCCATTACACTGCAACCTATGTCTTCCAGGCTC AAGCAGTCTTTCTACCAGCTTCCCGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001204827
Insert Size	168 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001204827.1
RefSeq Size	1462 bp
RefSeq ORF	168 bp
Locus ID	63929
Protein Families	Druggable Genome, Protease
MW	6.2 kDa
Gene Summary	The protein encoded by this gene belongs to the family of X-pro-aminopeptidases that utilize a metal cofactor, and remove the N-terminal amino acid from peptides with a proline residue in the penultimate position. This protein has been shown to localize to the mitochondria of renal cells, and have a role in ciliary function. Mutations in this gene are associated with nephronophthisis-like nephropathy-1. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene, however, expression of some of these isoforms in vivo is not known.[provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) shares the first exon in common with variant 1 and contains two alternate exons at the 3' end. This results in a frame-shift and a very short isoform (2) with a distinct C-terminus compared to isoform 1. This variant is supported by transcript evidence, but the encoded isoform lacks experimental support.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.