B4GALT3 (B4GALT2) (NM_030587) Human Untagged Clone

CAT#: SC333296

B4GALT2 (untagged) - Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 (B4GALT2), transcript variant 1



  "NM_030587" in other vectors (2)

CNY 3,800.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
B4GALT2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B4Gal-T2; B4Gal-T3; beta4Gal-T2
Vector pCMV6-Entry
Sequence Data
>SC333296 representing NM_030587.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGTGGAAGTCCAGGAGCAGTGGCCTTGTTTGCCAGCAGCCGGATGCCCGGGCCCACTGGGCGGG
CCAGTGGCCGCCTGCGGGATGAGCAGACTGCTGGGGGGGACGCTGGAGCGCGTCTGCAAGGCTGTGCTC
CTTCTCTGCCTGCTGCACTTCCTCGTGGCCGTCATCCTCTACTTTGACGTCTACGCCCAGCACCTGGCC
TTCTTCAGCCGCTTCAGTGCCCGAGGCCCTGCCCATGCCCTCCACCCAGCTGCTAGCAGCAGCAGCAGC
AGCAGCAACTGCTCCCGGCCCAACGCCACCGCCTCTAGCTCCGGGCTCCCTGAGGTCCCCAGTGCCCTG
CCCGGTCCCACGGCTCCCACGCTGCCACCCTGTCCTGACTCGCCACCTGGTCTTGTGGGCAGACTGCTG
ATCGAGTTCACCTCACCCATGCCCCTGGAGCGGGTGCAGAGGGAGAACCCAGGCGTGCTCATGGGCGGC
CGATACACACCGCCCGACTGCACCCCAGCCCAGACGGTGGCGGTCATCATCCCCTTTAGACACCGGGAA
CACCACCTGCGCTACTGGCTCCACTATCTACACCCCATCTTGAGGCGGCAGCGGCTGCGCTACGGCGTC
TATGTCATCAACCAGCATGGTGAGGACACCTTCAACCGGGCCAAGCTGCTTAACGTGGGCTTCCTAGAG
GCGCTGAAGGAGGATGCCGCCTATGACTGCTTCATCTTCAGCGATGTGGACCTGGTCCCCATGGATGAC
CGCAACCTATACCGCTGCGGCGACCAACCCCGCCACTTTGCCATTGCCATGGACAAGTTTGGCTTCCGG
CTTCCCTATGCTGGCTACTTTGGAGGTGTGTCAGGCCTGAGTAAGGCTCAGTTTCTGAGAATCAATGGC
TTCCCCAATGAGTACTGGGGCTGGGGTGGCGAGGATGATGACATCTTCAACCGGATCTCCCTGACTGGG
ATGAAGATCTCACGCCCAGACATCCGAATCGGCCGCTACCGCATGATCAAGCACGACCGCGACAAGCAT
AACGAACCTAACCCTCAGAGGTTTACCAAGATTCAAAACACGAAGCTGACCATGAAGCGGGACGGCATT
GGGTCAGTGCGGTACCAGGTCTTGGAGGTGTCTCGGCAACCACTCTTCACCAATATCACAGTGGACATT
GGGCGGCCTCCGTCGTGGCCCCCTCGGGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_030587
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030587.2
RefSeq Size 2010 bp
RefSeq ORF 1206 bp
Locus ID 8704
UniProt ID O60909
Domains Galactosyl_T_2
Protein Families Transmembrane
Protein Pathways Galactose metabolism, Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways, N-Glycan biosynthesis
MW 44.8 kDa
Gene Summary This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...