PAQR6 (NM_001272107) Human Untagged Clone

CAT#: SC333216

PAQR6 (untagged) - Homo sapiens progestin and adipoQ receptor family member VI (PAQR6), transcript variant 6



  "NM_001272107" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PAQR6 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRdelta
Vector pCMV6-Entry
Sequence Data
>SC333216 representing NM_001272107.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGCCCCGCATGCGCCACATCTGCTACTTCCTCGACTACGGCGCGCTCAGCCTCTACAGTCTGGGC
TGCGCCTTCCCCTATGCCGCCTACTCCATGCCGGCCTCCTGGCTGCACGGCCACCTGCACCAGTTCTTT
GTGCCTGCCGCCGCACTCAACTCCTTCCTGTGCACCGGCCTCTCCTGCTACTCCCGTTTCCTGGAGCTG
GAAAGCCCTGGGCTCAGTAAGGTCCTCCGCACAGGAGCCTTCGCCTATCCATTCCTGTTCGACAACCTC
CCACTCTTTTATCGGCTCGGGCTGTGCTGGGGCAGGGGCCACGGCTGTGGGCAGGAGGCCCTGAGCACC
AGCCATGGCTACCATCTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGG
CTGGCACCAGGACGCTTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGC
ACCCACTTCCAGCTGGAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAA
CCTGCCCTGGGCCTGGCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATT
GCTGCTTTCACAGCCACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAG
GGGGGTACCCAGGCCAAACAACAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001272107
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272107.1
RefSeq Size 2206 bp
RefSeq ORF 717 bp
Locus ID 79957
UniProt ID Q6TCH4
Protein Families Druggable Genome, Transmembrane
MW 25.8 kDa
Gene Summary Plasma membrane progesterone (P4) receptor coupled to G proteins (PubMed:23763432, PubMed:23161870). Seems to act through a G(s) mediated pathway (PubMed:23161870). Involved in neurosteroid inhibition of apoptosis (PubMed:23161870). May be involved in regulating rapid P4 signaling in the nervous system (PubMed:23763432). Also binds dehydroepiandrosterone (DHEA), pregnanolone, pregnenolone and allopregnanolone (PubMed:23763432, PubMed:23161870).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) uses an alternate splice site at an internal exon in the 3' coding region, compared to variant 1. It encodes isoform 5 which has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...