RRAGC (NM_001271851) Human Untagged Clone

CAT#: SC333138

RRAGC (untagged) - Homo sapiens Ras-related GTP binding C (RRAGC), transcript variant 2



  "NM_001271851" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RRAGC Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GTR2; RAGC; TIB929
Vector pCMV6-Entry
Sequence Data
>SC333138 representing NM_001271851.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCTGCAGTACGGGGCGGAGGAGACGCCCCTCGCCGGCAGTTACGGCGCGGCCGATTCGTTTCCA
AAGGACTTCGGCTACGGCGTGGAGGAGGAGGAAGAGGAGGCGGCGGCGGCGGGCGGAGGGGTTGGGGCA
GGGGCAGGCGGTGGCTGTGGTCCGGGGGGCGCTGACAGCTCCAAGCCGAGGATTCTGCTCATGGGACTC
CGGCGCAGCGGCAAGTCCTCCATCCAGAAGATATGGGATTTTCCTGGGCAAATGGACTTTTTTGACCCA
ACCTTTGACTATGAGATGATCTTCAGGGGAACAGGAGCATTGATATACGTCATTGACGCACAGGATGAC
TACATGGAGGCTTTAACAAGACTTCACATTACTGTTTCTAAAGCCTACAAAGTTAACCCAGACATGAAT
TTTGAGGTTTTTATTCACAAAGTTGATGGTCTGTCTGATGATCACAAAATAGAAACACAGAGGGACATT
CATCAAAGGGCCAATGATGACCTTGCAGATGCTGGGCTAGAAAAACTCCATCTTAGCTTTTATCTGACT
AGTATCTATGACCATTCAATATTTGAAGCCTTTAGTAAGGTGGTGCAGAAACTCATTCCACAACTGCCG
ACCTTGGAAAACCTATTAAATATCTTTATATCAAATTCAGGTATTGAAAAAGCTTTTCTCTTTGATGTT
GTCAGCAAAATCTACATTGCAACAGACAGTTCCCCTGTGGATATGCAATCTTATGAACTTTGCTGTGAC
ATGATCGATGTTGTAATTGATGTGTCTTGTATATATGGGTTAAAGGAAGATGGAAGTGGAAGTGCTTAT
GACAAAGAATCTATGGCAATTATCAAGCTGAATAATACAACTGTCCTTTATTTAAAGGAGGTGACTAAA
TTTTTGGCACTGGTCTGCATTCTAAGGGAAGAAAGCTTTGAAAGAAAAGGTTTAATAGACTACAACTTC
CACTGTTTCCGAAAAGCTATTCATGAGGTTTTTGAGGTGGGTGTGACTTCTCACAGGAGCTGTGGTCAC
CAGACTAGTGCCTCCAGTCTGAAAGCGCTGACACACAATGGCACGCCACGAAACGCCATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271851
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271851.1
RefSeq Size 2644 bp
RefSeq ORF 1098 bp
Locus ID 64121
UniProt ID Q9HB90
Protein Families Transcription Factors
MW 40.3 kDa
Gene Summary This gene encodes a member of the GTR/RAG GTP-binding protein family. The encoded protein is a monomeric guanine nucleotide-binding protein which forms a heterodimer with RRAGA and RRAGB and is primarily localized to the cytoplasm. The encoded protein promotes intracellular localization of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...