Dysbindin (DTNBP1) (NM_001271667) Human Untagged Clone

CAT#: SC333080

DTNBP1 (untagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 3



  "NM_001271667" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-DTNBP1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLOC1S8; DBND; HPS7; My031; SDY
Vector pCMV6-Entry
Sequence Data
>SC333080 representing NM_001271667.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTC
CCAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAG
GTAGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGGCAGTGTGAATTAGAAAGATGCAAACATATG
CAGTCCCAGCAACTGGAGAATTACAAGAAAAATAAGAGGAAGGAACTTGAAACCTTCAAAGCTGAACTA
GATGCAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGAAGCTGAAGGAGCGGCAG
AAGTTTTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACCTGTCCACTGGCTACCTGCAGATTGCA
GAGCGGCGAGAGCCCATAGGCAGCATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGAC
CTGATGGACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTG
CTGTCCCCCGCCTTAGGGCCTGAATCCAGTACCTGTCAGAATGAGATTACCCTCCAGGTTCCAAATCCC
TCAGAATTAAGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGACTCGGCCACCCGGGACATCAGT
GAGGGTGGGGAGTCCCCCGTTGTTCAGTCCGATGAGGAGGAAGTTCAGGTGGACACTGCCCTGGCCACA
TCACACACTGACAGAGAGGCCACTCCGGATGGTGGTGAGGACAGCGACTCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271667
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271667.1
RefSeq Size 1469 bp
RefSeq ORF 813 bp
Locus ID 84062
UniProt ID Q96EV8
Protein Families Druggable Genome
MW 30.4 kDa
Gene Summary This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) contains an alternate splice site in the 5' coding region and is predicted to use a downstream start codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus than isoform a. This variant and protein are described by Talbot et al. (PMID:21390302).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...