C1orf149 (MEAF6) (NM_001270875) Human Untagged Clone

CAT#: SC333006

MEAF6 (untagged) - Homo sapiens MYST/Esa1-associated factor 6 (MEAF6), transcript variant 2



  "NM_001270875" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-FLJ11730 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf149; CENP-28; EAF6; NY-SAR-91
Vector pCMV6-Entry
Sequence Data
>SC333006 representing NM_001270875.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGATGCACAACAAGGCGGCGCCGCCGCAGATCCCGGACACCCGGCGGGAGCTGGCGGAGCTCGTG
AAGCGGAAGCAGGAGCTGGCGGAAACATTGGCAAATTTGGAGCGACAGATCTATGCTTTTGAGGGAAGC
TACCTGGAAGACACTCAGATGTATGGCAATATTATTCGTGGCTGGGATCGGTATCTGACCAACCAAAAA
AACTCCAATAGCAAAAATGATCGAAGGAACCGGAAGTTTAAGGAAGCTGAGCGGCTCTTCAGTAAATCC
TCGGTTACCTCAGCAGCTGCAGTAAGTGCATTGGCAGGAGTTCAGGACCAGCTCATTGAAAAGAGGGAG
CCAGGAAGTGGGACGGAAAGTGACACTTCTCCAGACTTCCACAATCAGGAAAATGAGCCCAGCCAGGAG
GACCCTGAGGATCTGGATGGATCTGTGCAGGGAGTGAAACCTCAGAAGGCTGCTTCTTCTACTTCCTCA
GGGAGTCACCACAGCAGCCATAAAAAGCGAAAGAATAAAAACCGGCACAGGATTGATCTGAAGTTAAAC
AAAAAACCACGAGCTGACTATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270875
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270875.1
RefSeq Size 4788 bp
RefSeq ORF 576 bp
Locus ID 64769
UniProt ID Q9HAF1
MW 21.6 kDa
Gene Summary This gene encodes a nuclear protein involved in transcriptional activation. The encoded protein may form a component of several different histone acetyltransferase complexes. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) lacks an alternate exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...