mtTFA (TFAM) (NM_001270782) Human Untagged Clone

CAT#: SC333002

TFAM (untagged) - Homo sapiens transcription factor A, mitochondrial (TFAM), transcript variant 2



  "NM_001270782" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TFAM Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTDPS15; MTTF1; MTTFA; TCF6; TCF6L1; TCF6L2; TCF6L3
Vector pCMV6-Entry
Sequence Data
>SC333002 representing NM_001270782.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAGCTGTGCACC
GGCTGTGGAAGTCGACTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGGTGGTTTTCATCTGTCTTG
GCAAGTTGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTTTCTAAAGAACAACTACCCATATTTAAA
GCTCAGAACCCAGATGCAAAAACTACAGAACTAATTAGAAGAATTGCCCAGCGTTGGAGGGAACTTCCT
GATTCAAAGAAAAAAATATATCAAGATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGC
AGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTA
AAAAGGAAAGCTATGACAAAAAAAAAAGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCT
GACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAG
TCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAATAAAGAAACAACGA
AAATATGGTGCTGAGGAGTGTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270782
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270782.1
RefSeq Size 5223 bp
RefSeq ORF 645 bp
Locus ID 7019
UniProt ID Q00059
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Huntington's disease
MW 25.5 kDa
Gene Summary This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2, also known as tr6 or delta 5TFam) lacks an exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...