Monoamine Oxidase A (MAOA) (NM_001270458) Human Untagged Clone

CAT#: SC332947

MAOA (untagged) - Homo sapiens monoamine oxidase A (MAOA), transcript variant 2



  "NM_001270458" in other vectors (2)

CNY 3,800.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-MAOA Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRNRS; MAO-A
Vector pCMV6-Entry
Sequence Data
>SC332947 representing NM_001270458.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACC
ATGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAAT
ATCAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGG
GGCACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAA
GTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGAC
CAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAAT
GCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTA
ATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAG
AAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACC
AAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAG
CTACATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCT
TTACATCCAGTGCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCC
TACTTCCCTCCTGGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTT
GCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCA
GCTAGGGAGGTCTTAAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCA
AAGGACGTTCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTG
CTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTG
CCACGGTCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270458
Insert Size 1185 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270458.1
RefSeq Size 5438 bp
RefSeq ORF 1185 bp
Locus ID 4128
UniProt ID P21397
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Drug metabolism - cytochrome P450, Glycine, serine and threonine metabolism, Histidine metabolism, Metabolic pathways, Phenylalanine metabolism, Tryptophan metabolism, Tyrosine metabolism
MW 44.8 kDa
Gene Summary This gene is one of two neighboring gene family members that encode mitochondrial enzymes which catalyze the oxidative deamination of amines, such as dopamine, norepinephrine, and serotonin. Mutation of this gene results in Brunner syndrome. This gene has also been associated with a variety of other psychiatric disorders, including antisocial behavior. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR and uses a downstream, in-frame start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...