PRSS21 (NM_001270452) Human Untagged Clone

CAT#: SC332943

PRSS21 (untagged) - Homo sapiens protease, serine, 21 (testisin) (PRSS21), transcript variant 4



  "NM_001270452" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PRSS21 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ESP-1; ESP1; TEST1; TESTISIN
Vector pCMV6-Entry
Sequence Data
>SC332943 representing NM_001270452.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCGCGCGCGGGGCGCTGCTGCTGGCGCTGCTGCTGGCTCGGGCTGGACTCAGGAAGCCGGAGTCG
CAGGAGGCGGCGCCGTTATCAGGACCATGCGGCCGACGGGTCATCACGTCGCGCATCGTGGGTGGAGAG
GACGCCGAACTCGGGCGTTGGCCGTGGCAGGGGAGCCTGCGCCTGTGGGATTCCCACGTATGCGGAGTG
AGCCTGCTCAGCCACCGCTGGGCACTCACGGCGGCGCACTGCTTTGAAACTGACCTTAGTGATCCCTCC
GGGTGGATGGTCCAGTTTGGCCAGCTGACTTCCATGCCATCCTTCTGGAGCCTGCAGGCCTACTACACC
CGTTACTTCGTATCGAATATCTATCTGAGCCCTCGCTACCTGGGGAATTCACCCTATGACATTGCCTTG
GTGAAGCTGTCTGCACCTGTCACCTACACTAAACACATCCAGCCCATCTGTCTCCAGGCCTCCACATTT
GAGTTTGAGAACCGGACAGACTGCTGGGTGACTGGCTGGGGGTACATCAAAGAGGATGAGGGAAGTTCA
GGTCGCCATCATAAACAACTCTATGTGCAACCACCTCTTCCTCAAGTACAGTTTCCGCAAGGACATCTT
TGGAGACATGGTTTGTGCTGGCAATGCCCAAGGCGGGAAGGATGCCTGCTTCGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270452
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270452.1
RefSeq Size 1136 bp
RefSeq ORF 678 bp
Locus ID 10942
UniProt ID Q9Y6M0
Protein Families Druggable Genome
MW 25.5 kDa
Gene Summary This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (4) uses two alternate splice sites in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...