Junctional Adhesion Molecule 2 (JAM2) (NM_001270407) Human Untagged Clone

CAT#: SC332924

JAM2 (untagged) - Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant 2



  "NM_001270407" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to JAM-B (junctional adhesion molecule 2)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C21orf43; CD322; IBGC8; JAM-B; JAMB; PRO245; VE-JAM; VEJAM
Vector pCMV6-Entry
Sequence Data
>SC332924 representing NM_001270407.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGAGGAGGAGCCGCCACCGCCTCCTCCTGCTGCTGCTGCGCTACCTGGTGGTCGCCCTGGGCTAT
CATAAGGCCTATGGGTTTTCTGCCCCAAAAGACCAACAAGTAGTCACAGCAGTAGAGTACCAAGGTGAT
TTTAAAAATCGAGCTGAGATGATAGATTTCAATATCCGGATCAAAAATGTGACAAGAAGTGATGCGGGG
AAATATCGTTGTGAAGTTAGTGCCCCATCTGAGCAAGGCCAAAACCTGGAAGAGGATACAGTCACTCTG
GAAGTATTAGTGGCTCCAGCAGTTCCATCATGTGAAGTACCCTCTTCTGCTCTGAGTGGAACTGTGGTA
GAGCTACGATGTCAAGACAAAGAAGGGAATCCAGCTCCTGAATACACATGGTTTAAGGATGGCATCCGT
TTGCTAGAAAATCCCAGACTTGGCTCCCAAAGCACCAACAGCTCATACACAATGAATACAAAAACTGGA
ACTCTGCAATTTAATACTGTTTCCAAACTGGACACTGGAGAATATTCCTGTGAAGCCCGCAATTCTGTT
GGATATCGCAGGTGTCCTGGGAAACGAATGCAAGTAGATGATCTCAACATAAGTGGCATCATAGCAGCC
GTAGTAGTTGTGGCCTTAGTGATTTCCGTTTGTGGCCTTGGTGTATGCTATGCTCAGAGGAAAGGCTAC
TTTTCAAAAGAAACCTCCTTCCAGAAGAGTAATTCTTCATCTAAAGCCACGACAATGAGTGAAAATGAT
TTCAAGCACACAAAATCCTTTATAATTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270407
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270407.1
RefSeq Size 4249 bp
RefSeq ORF 789 bp
Locus ID 58494
UniProt ID P57087
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Epithelial cell signaling in Helicobacter pylori infection, Leukocyte transendothelial migration, Tight junction
MW 29 kDa
Gene Summary This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, which results in a shorter isoform (2) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Junctional Adhesion Molecule 2产品

Customer Reviews 
Loading...