alpha Tubulin (TUBA1A) (NM_001270399) Human Untagged Clone

CAT#: SC332920

TUBA1A (untagged) - Homo sapiens tubulin, alpha 1a (TUBA1A), transcript variant 2



  "NM_001270399" in other vectors (2)

CNY 4,370.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TUBA1A mouse monoclonal antibody, clone OTI2C8 (formerly 2C8)
    • 100 ul

CNY 600.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B-ALPHA-1; LIS3; TUBA3
Vector pCMV6-Entry
Sequence Data
>SC332920 representing NM_001270399.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTC
TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGAT
GATTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGAC
TTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTT
ATCACAGGCAAAGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATT
GACCTCGTGTTGGACCGAATTCGCAAGCTGGCCGACCAGTGCACGGGTCTCCAGGGCTTCTTGGTTTTC
CACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCGCTGCTCATGGAACGTCTCTCAGTTGATTAT
GGCAAGAAGTCCAAGCTGGAGTTCTCTATTTACCCGGCGCCCCAGGTTTCCACAGCTGTAGTTGAGCCC
TACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAG
GCCATCTATGACATCTGTCGTAGAAACCTCGATATTGAGCGTCCAACCTATACTAACCTGAATAGGTTA
ATAGGTCAAATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACA
GAATTCCAGACCAACCTGGTGCCCTATCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATC
TCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCC
AACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGAC
GTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAGACCAAGCGTACCATCCAGTTTGTGGAT
TGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTG
GCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTG
GACCACAAGTTTGACCTGATGTATGCCAAACGTGCCTTTGTTCACTGGTACGTTGGGGAGGGGATGGAG
GAAGGTGAGTTTTCAGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTG
GATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270399
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270399.1
RefSeq Size 2490 bp
RefSeq ORF 1356 bp
Locus ID 7846
UniProt ID Q71U36
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
MW 50.1 kDa
Gene Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (2) contains an alternate segment at its 5' end which results in the use of a different start codon, compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1) but use distinct start codons.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...