ILF2 (NM_001267809) Human Untagged Clone

CAT#: SC332881

ILF2 (untagged) - Homo sapiens interleukin enhancer binding factor 2 (ILF2), transcript variant 2



  "NM_001267809" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-ILF2 mouse monoclonal antibody, clone OTI6F1 (formerly 6F1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NF45; PRO3063
Vector pCMV6-Entry
Sequence Data
>SC332881 representing NM_001267809.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTTTCCCCGGGTCAAGCCAGCACCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAAT
CAGGACCTGGCTCCCAATTCTGCTGAACAGGCATCTATCCTTTCTCTGGTGACAAAAATAAACAATGTG
ATTGATAATCTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCC
TATAAAAAGGGGACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTGATACTCAAGATTCTGCCA
ACGTTGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGAGCACAGGATCCTTCTGAA
GTTTTAACCATGCTGACCAACGAAACTGGCTTTGAAATCAGTTCTTCTGATGCTACAGTGAAGATTCTC
ATTACAACAGTGCCACCCAATCTTCGAAAACTGGATCCAGAACTCCATTTGGATATCAAAGTATTGCAG
AGTGCCTTAGCAGCCATCCGACATGCCCGCTGGTTCGAGGAAAATGCTTCTCAGTCCACAGTTAAAGTT
CTCATCAGACTACTGAAGGACTTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTT
GACCTACTAGGCCATTATGCTGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTTGCATAC
AGGCGCTGCTTGCAGATTCTGGCTGCAGGACTGTTCCTGCCAGGTTCAGTGGGTATCACTGACCCCTGT
GAGAGTGGCAACTTTAGAGTACACACAGTCATGACCCTAGAACAGCAGGACATGGTCTGCTATACAGCT
CAGACTCTCGTCCGAATCCTCTCACATGGTGGCTTTAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGC
TATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTAACACCTTCAGAAAAGGCTTATGAGAAG
CCACCAGAGAAGAAGGAAGGAGAGGAAGAAGAGGAGAATACAGAAGAACCACCTCAAGGAGAGGAAGAA
GAAAGCATGGAAACTCAGGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267809
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267809.1
RefSeq Size 1953 bp
RefSeq ORF 1059 bp
Locus ID 3608
UniProt ID Q12905
Protein Families Druggable Genome, Transcription Factors
MW 38.9 kDa
Gene Summary The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) uses an alternate splice site in its 5' UTR and uses an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...