PRB4 (NM_001261399) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	Po
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332757 representing NM_001261399. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCTGCTGATTCTGCTGTCAGTGGCCCTGCTGGCCCTGAGCTCAGCTGAGAGTTCAAGTGAAGATGTC AGCCAGGAAGAATCTCTCTTCCTAATATCAGGAAAGCCAGAAGGACGACGCCCACAAGGAGGAAACCAG CCCCAACGTCCCCCACCTCCTCCAGGAAAGCCACAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAA GGTCCCCCACCTCCTCCAGGAAAGCCAGAAGGACGACCCCCACAAGGAGGCAACCAGTCCCAAGGTCCC CCACCTCATCCAGGAAAGCCAGAAAGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGAAAGCCACAA GGACCACCCCAACAAGAAGGCAACAAGCCTCAAGGTCCCCCACCTCCTGGAAAGCCACAAGGCCCACCC CCAGCAGGAGGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGAAAGCCCCAGGGGCCACCTCCACCT CCTCAAGGGGGCAGGCCACCCAGACCTGCCCAGGGACAACAGCCTCCCCAGTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001261399
Insert Size	537 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001261399.1
RefSeq Size	740 bp
RefSeq ORF	537 bp
Locus ID	5545
Protein Families	Druggable Genome
MW	18 kDa
Gene Summary	This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Small" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter, compared to isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.