ATPSCKMT (NM_001258388) Human Untagged Clone
CAT#: SC332685
FAM173B (untagged) - Homo sapiens family with sequence similarity 173, member B (FAM173B), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAM173B; hFAM173B; JS-2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332685 representing NM_001258388.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGGGAGGAGGAGGTATACCCCTAGAAACACTTAAAGAAGAAAGTCAGTCAAGACATGTTCTACCT GCAAGTTTTGAAGTCAACAGTTTGCAGAAAAGCAACTGGGGGTTCTTACTTACTGGGCTTGTGGGTGGC ACCCTGGTGGCTGTGTACGCTGTAGCCACGCCGTTTGTAACGCCAGCCCTTCGAAAAGTCTGTTTGCCG TTTGTACCTGCAACTACGAAGCAGATTGAAAATGTTGTGAAAATGTTGCGATGCCGAAGAGGATCCCTT GTGGACATCGGTAGTGGGGACGGACGCATTGTCATAGCGGCTGCGAAGAAAGGGTTCACAGCAGTTGGT TATGAATTAAACCCATGGCTAGTTTGGTATTCCAGATACCGCGCTTGGCGAGAAGGTGTGCATGGATCT GCCAAATTTTATATTTCAGATTTGTGGAAGATGCTGCAGTTGGAGAAGAAACTTGAACGTGAACTTGAG GATGATGCACGAGTTATTGCTTGCCGGTTCCCTTTCCCACATTGGACTCCAGACCACGTCACGGGGGAG GGGATAGACACAGTGTGGGCATATGATGCAAGCACTTTTAGAGGCCGTGAAAAGAGGCCCTGTACATCG ATGCATTTCCAGCTGCCCATTCAAGCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258388 |
Insert Size | 651 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001258388.1 |
RefSeq Size | 2621 bp |
RefSeq ORF | 651 bp |
Locus ID | 134145 |
UniProt ID | Q6P4H8 |
Protein Families | Druggable Genome, Transmembrane |
MW | 24.2 kDa |
Gene Summary | Mitochondrial protein-lysine N-methyltransferase that trimethylates ATP synthase subunit C, ATP5MC1 and ATP5MC2. Trimethylation is required for proper incorporation of the C subunit into the ATP synthase complex and mitochondrial respiration (PubMed:29444090, PubMed:30530489). Promotes chronic pain (PubMed:29444090). Involved in persistent inflammatory and neuropathic pain: methyltransferase activity in the mitochondria of sensory neurons promotes chronic pain via a pathway that depends on the production of reactive oxygen species (ROS) and on the engagement of spinal cord microglia (PubMed:29444090).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233466 | FAM173B (Myc-DDK tagged) - Homo sapiens family with sequence similarity 173, member B (FAM173B), transcript variant 2 |
CNY 3,990.00 |
|
RG233466 | FAM173B (tGFP-tagged) - Homo sapiens family with sequence similarity 173, member B (FAM173B), transcript variant 2 |
CNY 4,370.00 |
其它ATPSCKMT产品