HNF 4 alpha (HNF4A) (NM_001258355) Human Untagged Clone

CAT#: SC332670

HNF4A (untagged) - Homo sapiens hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 7



  "NM_001258355" in other vectors (2)

CNY 4,470.00


货期*
5周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
HNF4A mouse monoclonal antibody, clone OTI2H2 (formerly 2H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14
Vector pCMV6-Entry
Sequence Data
>SC332670 representing NM_001258355.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATTTTGTTGCCGCTGCGTCTCGCCAGATTGAGGCATCCCCTCCGACATCACTGGAGCATATCTGGA
GGGGTGGACAGTTCTCCACAGGGAGACACGTCCCCATCAGAAGGCACCAACCTCAACGCGCCCAACAGC
CTGGGTGTCAGCGCCCTGTGTGCCATCTGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGC
TGTGACGGCTGCAAGGGCTTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGC
CGGCAGTGCGTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGCTTCCGG
GCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGAAGGTCAAGCTATGAG
GACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTCCTGTCCCGACAGATCACCTCCCCC
GTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAGATTGCCAGCATCGCAGATGTGTGTGAGTCCATG
AAGGAGCAGCTGCTGGTTCTCGTTGAGTGGGCCAAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGAC
GACCAGGTGGCCCTGCTCAGAGCCCATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATG
GTGTTCAAGGACGTGCTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAG
ATGAGCCGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGATGAC
AATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCTGAGCGATCCAGGG
AAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTACATCAACGACCGCCAGTATGAC
TCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCCCACCTTGCAGAGCATCACCTGGCAGATGATC
GAGCAGATCCAGTTCATCAAGCTCTTCGGCATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTG
GGAGGGTCCCCCAGCGATGCACCCCATGCCCACCACCCCCTGCACCCTCACCTGATGCAGGAACATATG
GGAACCAACGTCATCGTTGCCAACACAATGCCCACTCACCTCAGCAACGGACAGATGTGTGAGTGGCCC
CGACCCAGGGGACAGGCAGCCACCCCTGAGACCCCACAGCCCTCACCGCCAGGTGGCTCAGGGTCTGAG
CCCTATAAGCTCCTGCCGGGAGCCGTCGCCACAATCGTCAAGCCCCTCTCTGCCATCCCCCAGCCGACC
ATCACCAAGCAGGAAGTTATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001258355
Insert Size 1404 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258355.1
RefSeq Size 4828 bp
RefSeq ORF 1404 bp
Locus ID 3172
UniProt ID P41235
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
MW 52 kDa
Gene Summary The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (7) contains an additional coding exon in the 5' region that results in translation initiation from an alternate downstream start codon compared to variant 2. The resulting shorter isoform (7) has a distinct N-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...