IKZF3 (NM_001257414) Human Untagged Clone

CAT#: SC332546

IKZF3 (untagged) - Homo sapiens IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 13



  "NM_001257414" in other vectors (2)

CNY 3,610.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
IKZF3 mouse monoclonal antibody, clone OTI7E11 (formerly 7E11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIO; AIOLOS; ZNFN1A3
Vector pCMV6-Entry
Sequence Data
>SC332546 representing NM_001257414.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGATATACAAACAAATGCGGAACTGAAAAGCACTCAGGAGCAGTCTGTGCCCGCAGAAAGTGCA
GCGGTTTTGAATGACTACAGTTTAACCAAATCTCATGAAATGGAAAATGTGGACAGTGGAGAAGGCCCA
GCCAATGAAGATGAAGACATAGGAGATGATTCAATGAAAGTGAAAGATGAATACAGTGAAAGAGATGAG
AATGTTTTAAAGTCAGAACCCATGGGAAATGCAGAAGAGCCTGAAATCCCTTACAGCTATTCAAGAGAA
TATAATGAATATGAAAACATTAAGTTGGAGAGACATGTTGTCTCATTCGATAGTAGCAGGCCAACCAGT
GGAAAGATGAACTGCGATGTGTGTGGATTATCCTGCATCAGCTTCAATGTCTTAATGGTTCATAAGCGA
AGCCATACTGGTGAGAAGCGCCACTGCTTTGATGTCAACTATAATTCAAGTTACATGTATGAGAAAGAG
AGTGAGCTCATACAGACCCGCATGATGGACCAAGCCATCAATAACGCCATCAGCTATCTTGGCGCCGAA
GCCCTGCGCCCCTTGGTCCAGACACCGCCTGCTCCCACCTCGGAGATGGTTCCAGTTATCAGCAGCATG
TATCCCATAGCCCTCACCCGGGCTGAGATGTCAAACGGTGCCCCTCAAGAGCTGGAAAAGAAAAGCATC
CACCTTCCAGAGAAGAGCGTGCCTTCTGAGAGAGGCCTCTCTCCCAACAATAGTGGCCACGACTCCACG
GACACTGACAGCAACCATGAAGAACGCCAGAATCACATCTATCAGCAAAATCACATGGTCCTGTCTCGG
GCCCGCAATGGGATGCCACTTCTGAAGGAGGTTCCCCGCTCTTACGAACTCCTCAAGCCCCCGCCCATC
TGCCCAAGAGACTCCGTCAAAGTGATCAACAAGGAAGGGGAGGTGATGGATGTGTATCGGTGTGACCAC
TGCCGCGTCCTCTTCCTGGACTATGTGATGTTCACGATTCACATGGGCTGCCACGGCTTCCGTGACCCT
TTCGAGTGTAACATGTGTGGATATCGAAGCCATGATCGGTATGAGTTCTCGTCTCACATAGCCAGAGGA
GAACACAGAGCCCTGCTGAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257414
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257414.1
RefSeq Size 9284 bp
RefSeq ORF 1128 bp
Locus ID 22806
UniProt ID Q9UKT9
MW 42.7 kDa
Gene Summary This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (13) lacks three alternate in-frame exons compared to variant 1. The resulting isoform (13, also known as Aio-del4,5,6) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...