ATP5A (ATP5A1) (NM_001257335) Human Untagged Clone

CAT#: SC332530

ATP5A1 (untagged) - Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1), transcript variant 5



  "NM_001257335" in other vectors (2)

CNY 4,750.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
ATP5A1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP5A; ATP5A1; ATP5AL2; ATPM; COXPD22; hATP1; HEL-S-123m; MC5DN4; MOM2; OMR; ORM
Vector pCMV6-Entry
Sequence Data
>SC332530 representing NM_001257335.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCTCTATTCTTGAAGAGCGTATTCTTGGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGT
GTCTTAAGTATTGGTGATGGTATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTA
GAGTTTTCTTCAGGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTT
GGAAATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTTCCAGTT
GGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGAAAGGGTCCAATTGGT
TCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATTCCTCGAATTTCAGTGCGGGAACCA
ATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTGCCAATTGGTCGTGGTCAGCGTGAACTGATTATT
GGTGACCGACAGACTGGGAAAACCTCAATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGAT
GGATCTGATGAAAAGAAGAAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCC
CAGTTGGTGAAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCG
GATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTTAGAGACAAT
GGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCTTACCGTCAGATGTCTCTG
TTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGATGTGTTCTACCTACACTCCCGGTTGCTG
GAGAGAGCAGCCAAAATGAACGATGCTTTTGGTGGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACA
CAGGCTGGTGATGTGTCTGCTTACATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTG
GAAACAGAATTGTTCTACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGA
TCCGCTGCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTATCGT
GAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTTTTGAGTCGTGGC
GTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCTATTGAAGAACAAGTGGCTGTT
ATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAGCCCAGCAAGATTACAAAGTTTGAGAATGCT
TTCTTGTCTCATGTCGTCAGCCAGCACCAAGCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCA
GAACAATCAGATGCAAAGCTGAAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA

Restriction Sites SgfI-RsrII     
ACCN NM_001257335
Insert Size 1512 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257335.1
RefSeq Size 2263 bp
RefSeq ORF 1512 bp
Locus ID 498
UniProt ID P25705
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 54.5 kDa
Gene Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate splice junction at the 3' end of an exon compared to variant 1, that causes a frameshift. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 4 and 5 both encode the same isoform (c).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...