FBXW7 (NM_001257069) Human Untagged Clone
CAT#: SC332501
FBXW7 (untagged) - Homo sapiens F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase (FBXW7), transcript variant 4
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGO; CDC4; FBW6; FBW7; FBX30; FBXO30; FBXW6; hAgo; hCdc4; SEL-10; SEL10 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332501 representing NM_001257069.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAATCAGGAACTGCTCTCTGTGGGCAGCAAAAGACGACGAACTGGAGGCTCTCTGAGAGGTAACCCT TCCTCAAGCCAGGTAGATGAAGAACAGATGAATCGTGTGGTAGAGGAGGAACAGCAACAGCAACTCAGA CAACAAGAGGAGGAGCACACTGCAAGGAATGGTGAAGTTGTTGGAGTAGAACCTAGACCTGGAGGCCAA AATGATTCCCAGCAAGGACAGTTGGAAGAAAACAATAATAGATTTATTTCGGTAGATGAGGACTCCTCA GGAAACCAAGAAGAACAAGAGGAAGATGAAGAACATGCTGGTGAACAAGATGAGGAGGATGAGGAGGAG GAGGAGATGGACCAGGAGAGTGACGATTTTGATCAGTCTGATGATAGTAGCAGAGAAGATGAACATACA CATACTAACAGTGTCACGAACTCCAGTAGTATTGTGGACCTGCCCGTTCACCAACTCTCCTCCCCATTC TATACAAAAACAACAAAAGTGAGTATATTCAATATATTGTTAACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257069 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001257069.1 |
RefSeq Size | 989 bp |
RefSeq ORF | 531 bp |
Locus ID | 55294 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Ubiquitin mediated proteolysis |
MW | 20 kDa |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (4) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 4 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233368 | FBXW7 (Myc-DDK tagged) - Homo sapiens F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase (FBXW7), transcript variant 4 |
CNY 3,990.00 |
|
RG233368 | FBXW7 (tGFP-tagged) - Homo sapiens F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase (FBXW7), transcript variant 4 |
CNY 4,370.00 |